Journal: Gut microbes

Article Title: Host miRNA-21 promotes liver dysfunction by targeting small intestinal Lactobacillus in mice.

doi: 10.1080/19490976.2020.1840766

Figure Lengend Snippet: Figure 1. miR-21KO mice are protected from bile duct ligation (BDL)-induced liver injury. (a) Representative images of hematoxylin and eosin (H&E) (upper panel) and TUNEL (lower panel) stained liver sections after sham operation and in WT and miR-21KO mice 3 days after BDL. Apoptotic cells are shown in red and nuclei are counterstained in blue with Hoechst 33258 dye. Scale bar, 50 μm. (b) Histology scores of inflammation and necrosis, and quantification of TUNEL-positive cells/mm2 in WT and miR-21KO mice 3 days after BDL. (c) Serum alkaline phosphatase (AP), alanine aminotransferase (ALT) and total bile acids in WT and miR-21KO mice after either sham operation or BDL for 3 days. (d) liver mRNA expression of Col1α1, α-Sma and Tgf-β in WT and miR-21KO mice after either sham operation or BDL for 3 days. (e) liver hydroxyproline levels and α-SMA protein in WT and miR-21KO mice after either sham operation or BDL for 3 days. Results are expressed in fold change as mean values with error bars ± SEM of 4–6 individual mice. Data were statistically analyzed with ANOVA Tukey’s multiple comparisons test *p < .05; **p < .01 and ***p < .001.

Article Snippet: Serum was collected for the evaluation of alanine aminotransferase (ALT) and alkaline phosphatase (AP) (ABX ALT and AP assay kit; Horiba) and total bile acids (3αhydroxysteroid dehydrogenase enzymatic assay kit; Randox Reagents).

Techniques: Ligation, TUNEL Assay, Staining, Expressing

Journal: Gut microbes

Article Title: Host miRNA-21 promotes liver dysfunction by targeting small intestinal Lactobacillus in mice.

doi: 10.1080/19490976.2020.1840766

Figure Lengend Snippet: Figure 5. Lactobacillus reuteri supplementation protects from bile duct ligation (BDL)-induced liver damage. (a) Representative images of hematoxylin and eosin (H&E) stained liver sections from control and Lactobacillus reuteri DSM 17938 (L. reuteri) supplemented mice after BDL for 3 days. (b) Histology scores for hepatocyte hypertrophy, lipidosis, bile duct hyperplasia, necrosis and inflammation in control and L. reuteri supplemented mice 3 days after BDL. (c) Serum alkaline phosphatase (AP), alanine aminotransferase (ALT) and total bile acids in control and L. reuteri supplemented mice 3 days after BDL. (d) mRNA expression of liver fibrosis markers Col1α1, α-Sma and Tgf-β in control and L. reuteri supplemented mice after BDL for 3 days. (e) Liver hydroxyproline and α-SMA protein levels in control and L. reuteri supplemented mice after BDL for 3 days. (f) mRNA expression levels of liver inflammatory markers Tnf-α, Il-1β, Mip-2 and Tlr-4 in control and L. reuteri supplemented mice after BDL for 3 days. (g) qPCR mRNA expression levels of L. reuteri in small intestinal lumen samples of control and L. reuteri supplemented mice after BDL for 3 days. (h) qPCR mRNA expression levels of liver D-Lactate dehydrogenase (D-Ldh) in control and L. reuteri supplemented mice after BDL for 3 days. (i) mRNA expression and protein levels of TGF-β in mouse macrophages stimulated with 1 mM of either D-Lactate or L-Lactate. Mean values of the in vivo experiments were calculated as fold change versus control with error bars ± SEM of 4–6 individual mice. Statistical analysis performed using unpaired t-test. Mean values of the in vitro assays were calculated as fold change versus control macrophages with error bars ± SEM of 5 individual experiments. Statistical analysis was performed with ANOVA Tukey’s multiple comparisons test. *p < .05, **p < .01 and ***p < .001.

Article Snippet: Serum was collected for the evaluation of alanine aminotransferase (ALT) and alkaline phosphatase (AP) (ABX ALT and AP assay kit; Horiba) and total bile acids (3αhydroxysteroid dehydrogenase enzymatic assay kit; Randox Reagents).

Techniques: Ligation, Staining, Control, Expressing, In Vivo, In Vitro

Journal: Experimental and therapeutic medicine

Article Title: Astragaloside IV alleviates heart failure by regulating SUMO-specific protease 1.

doi: 10.3892/etm.2021.10510

Figure Lengend Snippet: Figure 5. Effect of Senp1‑overexpression on H2O2 in HL‑1 cells. (A) The effects of different concentrations of AS‑IV (25, 50, 100 or 200 µmol/l) on the survival of HL‑1 cells subjected to ISO. One‑way ANOVA, followed by Tukey's test. (B) The expression of Senp1 protein was examined by Western blotting following HA‑Senp1 plasmid transfection. T‑test. (C) Compared with the control (dimethyl sulfoxide, 0.1%), H2O2 was increased in the 20 µmol/l ISO‑induced HL‑1 cells. AS‑IV (50 µmol/l, n=6) prevented the ISO‑induced increase in H2O2, which was inhibited by Senp1‑overexpression (n=7). Data are presented as the mean ± standard deviation. Two‑way ANOVA followed by Bonferroni's test. *P<0.05 vs. control; #P<0.05 vs. HF; &P<0.05 vs. HF+AS‑IV. H2O2, hydrogen peroxide; AS‑IV, astragaloside; ANOVA, analysis of variance; ISO, isoprenaline; Senp1, small ubiquitin‑like modifier‑specific protease 1.

Article Snippet: Fetal bovine serum (10099141C) and trypsin (25200072) were purchased from Gibco; Thermo Fisher Scientific, Inc. Antibodies against cleaved‐caspase‐3 (cat. no. 9661, 1:1,000), caspase‐3 (cat. no. 9662, 1:1,000), BCL2 (cat. no. 15071, 1:1,000), Bax (cat. no. 2774, 1:1,000), Senp1 (cat. no. 11929, 1:1,000) and β‐actin (cat. no. 3700, 1:1,000) were purchased from Cell Signaling Technology, Inc.

Techniques: Expressing, Western Blot, Plasmid Preparation, Transfection, Control, Standard Deviation

Journal: Experimental and therapeutic medicine

Article Title: Astragaloside IV alleviates heart failure by regulating SUMO-specific protease 1.

doi: 10.3892/etm.2021.10510

Figure Lengend Snippet: Figure 4. AS‑IV reversed the transverse aortic constriction‑induced expression of apoptosis‑related proteins and Senp1. (A) Apoptosis‑related proteins and Senp1 expression was examined by Western blotting. (B) Quantification of the results in A (n=6). Data are presented as the mean ± standard deviation. One‑way analysis of variance, followed by Tukey's test. *P<0.05 vs. control; #P<0.05 vs. HF. AS‑IV, astragaloside; Senp1, small ubiquitin‑like modifier‑specific protease 1; HF, heart failure; DMSO, dimethyl sulfoxide.

Article Snippet: Fetal bovine serum (10099141C) and trypsin (25200072) were purchased from Gibco; Thermo Fisher Scientific, Inc. Antibodies against cleaved‐caspase‐3 (cat. no. 9661, 1:1,000), caspase‐3 (cat. no. 9662, 1:1,000), BCL2 (cat. no. 15071, 1:1,000), Bax (cat. no. 2774, 1:1,000), Senp1 (cat. no. 11929, 1:1,000) and β‐actin (cat. no. 3700, 1:1,000) were purchased from Cell Signaling Technology, Inc.

Techniques: Expressing, Western Blot, Standard Deviation, Control

Journal: Experimental and therapeutic medicine

Article Title: Astragaloside IV alleviates heart failure by regulating SUMO-specific protease 1.

doi: 10.3892/etm.2021.10510

Figure Lengend Snippet: Figure 7. Effect of Senp1‑overexpression on mitochondrial membrane potential in HL‑1 cells. (A) Compared with the control (dimethyl sulfoxide, 0.1%), the JC‑1 ratio (aggregate/monomer) was decreased in 20 µmol/l ISO‑induced HL‑1 cells. AS‑IV (50 µmol/l, n=7) prevented the ISO‑induced decrease in the JC‑1 ratio, which was inhibited by Senp1‑overexpression (n=8). (B) Summarized data of the JC‑1 ratio. Data are presented as the mean ± standard devia‑ tion. Two‑way analysis of variance followed by Bonferroni's test. *P<0.05 vs. control; #P<0.05 vs. HF; &P<0.05 vs. HF+AS‑IV. Senp1, small ubiquitin‑like modifier‑specific protease 1; ISO, isoprenaline; AS‑IV, astragaloside.

Article Snippet: Fetal bovine serum (10099141C) and trypsin (25200072) were purchased from Gibco; Thermo Fisher Scientific, Inc. Antibodies against cleaved‐caspase‐3 (cat. no. 9661, 1:1,000), caspase‐3 (cat. no. 9662, 1:1,000), BCL2 (cat. no. 15071, 1:1,000), Bax (cat. no. 2774, 1:1,000), Senp1 (cat. no. 11929, 1:1,000) and β‐actin (cat. no. 3700, 1:1,000) were purchased from Cell Signaling Technology, Inc.

Techniques: Membrane, Control

Journal: Experimental and therapeutic medicine

Article Title: Astragaloside IV alleviates heart failure by regulating SUMO-specific protease 1.

doi: 10.3892/etm.2021.10510

Figure Lengend Snippet: Figure 6. Effect of Senp1‑overexpression on ROS generation in HL‑1 cells. (A) Compared with the control (dimethyl sulfoxide, 0.1%), DCF fluorescence was increased in 20 µmol/l ISO‑induced HL‑1 cells. AS‑IV (50 µmol/l, n=6) prevented the ISO‑induced increase in DCF fluorescence, which was inhibited by Senp1‑overexpression. (B) Summarized data of DCF fluorescence (n=7). Data are presented as the mean ± standard deviation. Two‑way analysis of variance, followed by Bonferroni's test. *P<0.05 vs. control; #P<0.05 vs. HF; &P<0.05 vs. HF+AS‑IV. Senp1, small ubiquitin‑like modifier‑specific protease 1; ROS, reac‑ tive oxygen species; ISO, isoprenaline; AS‑IV, astragaloside.

Article Snippet: Fetal bovine serum (10099141C) and trypsin (25200072) were purchased from Gibco; Thermo Fisher Scientific, Inc. Antibodies against cleaved‐caspase‐3 (cat. no. 9661, 1:1,000), caspase‐3 (cat. no. 9662, 1:1,000), BCL2 (cat. no. 15071, 1:1,000), Bax (cat. no. 2774, 1:1,000), Senp1 (cat. no. 11929, 1:1,000) and β‐actin (cat. no. 3700, 1:1,000) were purchased from Cell Signaling Technology, Inc.

Techniques: Control, Fluorescence, Standard Deviation

Journal: Experimental and therapeutic medicine

Article Title: Astragaloside IV alleviates heart failure by regulating SUMO-specific protease 1.

doi: 10.3892/etm.2021.10510

Figure Lengend Snippet: Figure 8. (A) TUNEL staining was used to examine cell apoptosis in HL‑1 cells. Compared with the control (dimethyl sulfoxide, 0.1%), cell apoptosis was increased in 20 µmol/l ISO‑induced HL‑1 cells. AS‑IV (50 µmol/l, n=10) prevented the ISO‑induced increase in cell apoptosis, which was inhibited by Senp1‑overexpression. (B) Summarized data of the cell apoptotic rate (n=7). Two‑way analysis of variance followed by Bonferroni's test. Data are presented as the mean ± standard deviation. *P<0.05 vs. control; #P<0.05 vs. HF; &P<0.05 vs. HF+AS‑IV. ISO, isoprenaline; AS‑IV, astragaloside; Senp1, small ubiquitin‑like modifier‑specific protease 1.

Article Snippet: Fetal bovine serum (10099141C) and trypsin (25200072) were purchased from Gibco; Thermo Fisher Scientific, Inc. Antibodies against cleaved‐caspase‐3 (cat. no. 9661, 1:1,000), caspase‐3 (cat. no. 9662, 1:1,000), BCL2 (cat. no. 15071, 1:1,000), Bax (cat. no. 2774, 1:1,000), Senp1 (cat. no. 11929, 1:1,000) and β‐actin (cat. no. 3700, 1:1,000) were purchased from Cell Signaling Technology, Inc.

Techniques: TUNEL Assay, Staining, Control, Standard Deviation

Journal: Antioxidants (Basel, Switzerland)

Article Title: Inhibition of Oxidative Stress and ALOX12 and NF-κB Pathways Contribute to the Protective Effect of Baicalein on Carbon Tetrachloride-Induced Acute Liver Injury.

doi: 10.3390/antiox10060976

Figure Lengend Snippet: Figure 2. Protein expression levels involved ferroptosis were detected in the liver tissues of mice challenged with CCl4. (A) Protein expression levels of ALOX12, HO-1, COX-2, p21 and Nrf2 at 6 and 24 h identified by Western blotting analysis of liver tissues of mice treated with CCl4; the quantitative analysis is showed in (B) (n = 4). 6 h vs. ctrl, * p < 0.05, ** p < 0.01; 24 h vs. ctrl, # p < 0.05, ## p < 0.01. Ctrl: control.

Article Snippet: The following primary antibodies were used to probe the membranes: primary rabbit antibodies against p21 (1:1000), COX2 (1:1000), Nrf2 (1:1000), and HO-1 (1:1000) (ProteinTech Group, Inc., Chicago, IL, USA), mouse monoclonal antibody against ALOX12 (1:1000) (Abcam, Cabridge, MA, USA) and β-actin (1:1000) (Santa Cruz Biotechnology, Dallas, TX, USA).

Techniques: Expressing, Western Blot, Control

Journal: Antioxidants (Basel, Switzerland)

Article Title: Inhibition of Oxidative Stress and ALOX12 and NF-κB Pathways Contribute to the Protective Effect of Baicalein on Carbon Tetrachloride-Induced Acute Liver Injury.

doi: 10.3390/antiox10060976

Figure Lengend Snippet: Figure 6. Effects of baicalein supplementation on apoptotic pathway in the liver tissues of mice challenged with CCl4. (A) Representative TUNEL-stained sections showing apoptosis in the liver tissue of mice. (B) Quantitative analysis of TUNEL positive rates (n = 4). (C,D) Activities of (C) caspases-3 and -9 (D) (n = 6). (E) The relative expression of Bax, GADD45a and p21 mRNAs in the liver tissues (n = 5). ** p < 0.01, compared to the control group; # p < 0.05 or ## p < 0.01, compared to the CCl4 only group. Bar = 100 µm. Bai: baicalein.

Article Snippet: The following primary antibodies were used to probe the membranes: primary rabbit antibodies against p21 (1:1000), COX2 (1:1000), Nrf2 (1:1000), and HO-1 (1:1000) (ProteinTech Group, Inc., Chicago, IL, USA), mouse monoclonal antibody against ALOX12 (1:1000) (Abcam, Cabridge, MA, USA) and β-actin (1:1000) (Santa Cruz Biotechnology, Dallas, TX, USA).

Techniques: TUNEL Assay, Staining, Expressing, Control

Journal: Brain : a journal of neurology

Article Title: Parkin interacting substrate phosphorylation by c-Abl drives dopaminergic neurodegeneration.

doi: 10.1093/brain/awab356

Figure Lengend Snippet: Figure 4 PARIS expression leads to p53 activation via PARIS Y137 phosphorylation-dependent epigenetic repression of MDM4. (A) Representative immunoblots examining the expression of MDM4, pS15-p53, p53 and FLAG (PARIS) in SH-SY5Y cells transfected with FLAG-PARIS wild-type or a Y137F mutant (48 h) using the indicated antibodies. b-Actin serves as an internal loading control. (B–D) Relative expression levels of MDM4 (B), p53 (C) and pS15-p53 (D) in the indicated experimental groups from A normalized to the internal loading control (b-actin; n = 3 per group). (E) Quantification of the relative expression of MDM4 mRNA in SH-SY5Y cells transfected (48 h) with mock or FLAG-PARIS and treated with TSA (300 nM, 42 h) deter- mined by RT-qPCR (normalized to internal GAPDH loading control; n = 3 per group). (F) Representative immunoblots of FLAG (PARIS) and MDM4 ex- pression in SH-SY5Y cells transfected (48 h) with mock or FLAG-PARIS and treated with TSA (300 nM, 42 h). (G) Quantification of the relative expression of MDM4 protein in the experimental groups in F normalized to b-actin (n = 3 per group). (H) A schematic diagram depicting the promoter structures of human MDM4 (hMDM4). IRS1, IRS2 and IRS3 motifs are indicated (top). Anti-acetyl-histone and anti-FLAG ChIP analysis of putative IRS (motif 1, 2 and 3) within the MDM4 promoter region in SH-SY5Y cells transfected with mock, or FLAG-PARIS wild-type (48 h, bottom) with or without the HDAC inhibitor TSA (300 nM, 42 h). The non-IRS region within the MDM4 promoter (Ctrl motif) was used as a negative control. Samples immuno- precipitated using either anti-histone antibodies or rabbit IgG were included as experimental controls in ChIP assays. (I) Quantification of relative ace- tylated histone enrichment on the indicated motifs located within MDM4 promoter determined by PCR amplification of ChIPed DNA in H (n = 3 per group). Data are expressed as mean SEM. *P 5 0.05, **P 5 0.01 and ***P 5 0.001 and statistical analysis was performed using an ANOVA test followed by Tukey’s post hoc analysis. WT = wild-type.

Article Snippet: The following primary antibodies were used: rabbit GFP antibody (Cell Signaling Technology; Cat No 2956; 1:5000), mouse GFP antibody (Santa Cruz Biotechnology, Cat No sc9996, 1:500), mouse FLAG antibody (Sigma; Cat No F1804; 1:50 for immunoprecipitation), rabbit PARIS (ZNF746) antibody (Proteintech; Cat No 24543-1-AP; 1:5000), rabbit antibody to phosphorylated c-Abl (Cell Signaling Technology; Cat No 2868; 1:5000), mouse c-Abl antibody (Sigma; Cat No A5844; 1:5000), rabbit MDM4 antibody (Proteintech; Cat No 17914-1-AP; 1:5000), mouse antibody to phosphorylated p53 (Cell Signaling Technology; Cat No 9284; 1:5000), mouse p53 antibody (Santa Cruz Biotechnology; Cat No sc126; 1:5000), mouse PGC-1a antibody (Calbiochem, Cat No ST1202), rabbit NRF1 antibody (Abcam, Cat No ab34682), rabbit tyrosine hydroxylase (TH) antibody (Novus Biologicals; Cat No NB300-109; 1:2000), mouse TH antibody (ImmunoStar; Cat No 22941; 1:2000), mouse parkin antibody (Cell Signaling Technology; Cat No 4211; 1:5000), rabbit acetyl-histone H3 antibody (Merck Millipore; Cat No 06-599; 1:20), rabbit Histone H3 antibody (Cell Signaling Technology; Cat No 4620; 1:20), horseradish peroxidase (HRP)-conjugated mouse FLAG antibody (Sigma; Cat No 8592; 1:5000), HRPconjugated mouse HA antibody (Cell Signaling Technology; Cat No 2999; 1:5000), and HRP-conjugated b-actin mouse antibody (Sigma; Cat No A3854; 1:10 000).

Techniques: Expressing, Activation Assay, Phospho-proteomics, Western Blot, Transfection, Mutagenesis, Control, Quantitative RT-PCR, Negative Control

Journal: Brain : a journal of neurology

Article Title: Parkin interacting substrate phosphorylation by c-Abl drives dopaminergic neurodegeneration.

doi: 10.1093/brain/awab356

Figure Lengend Snippet: Figure 5 Pharmacological inhibition of c-Abl activation restores behaviour/motor deficits and dopaminergic degeneration and prevents MDM4 repres- sion and p53 activation in mice with AAV-PARIS injection. (A) Representative exploratory paths from an open field test of mice that underwent AAV- Con or AAV-PARIS stereotaxic nigral injections (3 weeks) and treatment with the c-Abl inhibitor nilotinib (50 mg/kg/day, i.p. 2 weeks). (B) Anxiety assessment of each experimental mouse group by examining the percentage of exploration time in the border versus the sum of the centre and periphery zones (n = 9 AAV-Con-injected mice, n = 10 AAV-Con-injected mice + nilotinib, and n = 8 AAV-PARIS-injected mice). (C) Pole test for motor function assessment of each experimental mouse group used in B examining the latency to reach the base of vertical pole. (D) Motor coordination of each experimental mouse group used in B determined by the latency to fall in an accelerating rotarod test. (E) Representative TH immunohistochem- ical staining with Nissl counterstain of substantia nigra from mice that underwent AAV-Con or AAV-PARIS stereotaxic nigral injections (3 weeks) and treatment with the c-Abl inhibitor nilotinib (50 mg/kg/day, i.p. 2 weeks). The substantia nigra and ventral tegmental area regions are indicated by dot- ted yellow and white lines, respectively. Scale bar = 500 mm. (F) Stereological assessment of TH-positive dopaminergic neurons in the SNpc (injection side) in the indicated mouse groups (n = 4 AAV-Con-injected mice + DMSO, n = 5 AAV-Con-injected mice + nilotinib and n = 4 AAV-PARIS-injected mice). (G) Representative TUNEL assay images of ventral midbrain from mice that underwent stereotaxic nigral injection of AAV-Con or AAV-PARIS (3 weeks) and treatment with the c-Abl inhibitor nilotinib (50 mg/kg/day, i.p. 2 weeks). The coronal brain sections were counterstained with DAPI. (H) Quantification of the percentage of TUNEL-labelled cells in AAV-Con- or AAV-PARIS-injected ventral midbrain regions from mice with or without nilotinib treatment (n = 16 sections from four mice per group). (I) Representative immunoblots examining pY137-PARIS, PARIS, c-Abl, pY245-c-Abl, MDM4, pS15-p53 and p53 expression in the ventral midbrain of AAV-Con- or AAV-PARIS-injected mice with or without nilotinib treatment using the indicated antibodies. (J) Quantification of the relative expression of pY137-PARIS, PARIS, c-Abl, pY245-c-Abl MDM4, pS15-p53 and p53 proteins nor- malized to b-actin (n = 5 AAV-Con-injected mice and n = 4 AAV-PARIS-injected mice). Data are expressed as mean SEM. Statistical analyses was per- formed using an ANOVA test followed by Tukey’s post hoc analysis or an unpaired two-tailed Student’s t-test. **P 5 0.01 and ***P 5 0.001. DMSO = dimethyl sulphoxide; WT = wild-type.

Article Snippet: The following primary antibodies were used: rabbit GFP antibody (Cell Signaling Technology; Cat No 2956; 1:5000), mouse GFP antibody (Santa Cruz Biotechnology, Cat No sc9996, 1:500), mouse FLAG antibody (Sigma; Cat No F1804; 1:50 for immunoprecipitation), rabbit PARIS (ZNF746) antibody (Proteintech; Cat No 24543-1-AP; 1:5000), rabbit antibody to phosphorylated c-Abl (Cell Signaling Technology; Cat No 2868; 1:5000), mouse c-Abl antibody (Sigma; Cat No A5844; 1:5000), rabbit MDM4 antibody (Proteintech; Cat No 17914-1-AP; 1:5000), mouse antibody to phosphorylated p53 (Cell Signaling Technology; Cat No 9284; 1:5000), mouse p53 antibody (Santa Cruz Biotechnology; Cat No sc126; 1:5000), mouse PGC-1a antibody (Calbiochem, Cat No ST1202), rabbit NRF1 antibody (Abcam, Cat No ab34682), rabbit tyrosine hydroxylase (TH) antibody (Novus Biologicals; Cat No NB300-109; 1:2000), mouse TH antibody (ImmunoStar; Cat No 22941; 1:2000), mouse parkin antibody (Cell Signaling Technology; Cat No 4211; 1:5000), rabbit acetyl-histone H3 antibody (Merck Millipore; Cat No 06-599; 1:20), rabbit Histone H3 antibody (Cell Signaling Technology; Cat No 4620; 1:20), horseradish peroxidase (HRP)-conjugated mouse FLAG antibody (Sigma; Cat No 8592; 1:5000), HRPconjugated mouse HA antibody (Cell Signaling Technology; Cat No 2999; 1:5000), and HRP-conjugated b-actin mouse antibody (Sigma; Cat No A3854; 1:10 000).

Techniques: Inhibition, Activation Assay, Injection, Staining, TUNEL Assay, Western Blot, Expressing, Two Tailed Test

Journal: Brain : a journal of neurology

Article Title: Parkin interacting substrate phosphorylation by c-Abl drives dopaminergic neurodegeneration.

doi: 10.1093/brain/awab356

Figure Lengend Snippet: Figure 6 Pharmacological inhibition of c-Abl activity in in vivo adult parkin knockout mice prevents motor dysfunction and dopaminergic neurode- generation with concomitant blocking of PARIS phosphorylation and p53 activation. (A) Representative exploratory paths from an open-field test of 6-month-old wild-type littermate or homozygous floxed parkin mice (parkinfl/fl) nigrally injected with AAV-GFPCre (3 m) and treated with the c-Abl in- hibitor nilotinib (200 mg nilotinib per 1 kg diet, p.o. for 2 months) or standard chow diet (chow). (B) Anxiety assessment of each experimental mouse group examining the percentage of exploration time in the border versus the sum of the centre and periphery zones (n = 4 mice per group). (C) Pole test for motor function assessment of each experimental mouse group used in B examining the latency to reach the base of the vertical pole (n = 4 mice per group). (D) Representative TH immunohistochemical staining of substantia nigra from wild-type or homozygous floxed parkin mice (parkinfl/fl) with intranigral injection of AAV-GFPCre with or without nilotinib treatment (200 mg nilotinib per 1 kg diet, p.o. for 2 months). Scale bar = 500 mm. (E) Stereological assessment of TH-positive dopaminergic neurons in the SNpc (injection side) of the indicated mouse groups (n = 4 mice per group). (F) Representative TUNEL assay images of ventral midbrain from wild-type littermate or homozygous floxed parkin mice (parkinfl/fl) that expe- rienced stereotaxic nigral injection of AAV-GFPCre with or without nilotinib treatment (200 mg nilotinib per 1 kg diet, p.o. for 2 months). The coronal brain sections were counterstained with DAPI. Magnified images are shown in the bottom panel. (G) Quantification of the percentage of TUNEL- labelled cells in AAV-GFPCre-injected ventral midbrain regions from wild-type littermate and parkinfl/flmice with or without nilotinib treatment (n = 16 sections from four mice per group). (H) Representative immunofluorescence images examining the expression of pY245-c-Abl in TH-stained dopamine neurons from the AAV-GFPCre-injected ventral midbrain regions of wild-type littermate and parkinfl/flmice with or without nilotinib treat- ment. (I) Quantification of the relative pY245-c-Abl fluorescence signal in the ventral midbrain regions of the indicated experimental groups (n = 4 mice per group). (J) Representative immunofluorescence images examining the expression of pY137-PARIS in TH-stained dopamine neurons from the AAV-GFPCre-injected ventral midbrain regions of wild-type littermate and parkinfl/flmice with or without nilotinib treatment. (K) Quantification of the relative pY137-PARIS fluorescence signal in the ventral midbrain regions of the indicated experimental groups (n = 4 mice per group). (L) Representative immunofluorescence images examining the expression of pS15-p53 in TH-stained dopamine neurons from the AAV-GFPCre-injected ventral midbrain regions of wild-type littermate and parkinfl/flmice with or without nilotinib treatment. (M) Quantification of the relative pS15-p53 fluorescence signal in the ventral midbrain regions of the indicated experimental groups (n = 4 mice per group). Data are expressed as mean SEM. Statistical analysis was performed using an ANOVA test followed by Tukey’s post hoc analysis or an unpaired two-tailed Student’s t-test. ***P 5 0.001. WT = wild-type.

Article Snippet: The following primary antibodies were used: rabbit GFP antibody (Cell Signaling Technology; Cat No 2956; 1:5000), mouse GFP antibody (Santa Cruz Biotechnology, Cat No sc9996, 1:500), mouse FLAG antibody (Sigma; Cat No F1804; 1:50 for immunoprecipitation), rabbit PARIS (ZNF746) antibody (Proteintech; Cat No 24543-1-AP; 1:5000), rabbit antibody to phosphorylated c-Abl (Cell Signaling Technology; Cat No 2868; 1:5000), mouse c-Abl antibody (Sigma; Cat No A5844; 1:5000), rabbit MDM4 antibody (Proteintech; Cat No 17914-1-AP; 1:5000), mouse antibody to phosphorylated p53 (Cell Signaling Technology; Cat No 9284; 1:5000), mouse p53 antibody (Santa Cruz Biotechnology; Cat No sc126; 1:5000), mouse PGC-1a antibody (Calbiochem, Cat No ST1202), rabbit NRF1 antibody (Abcam, Cat No ab34682), rabbit tyrosine hydroxylase (TH) antibody (Novus Biologicals; Cat No NB300-109; 1:2000), mouse TH antibody (ImmunoStar; Cat No 22941; 1:2000), mouse parkin antibody (Cell Signaling Technology; Cat No 4211; 1:5000), rabbit acetyl-histone H3 antibody (Merck Millipore; Cat No 06-599; 1:20), rabbit Histone H3 antibody (Cell Signaling Technology; Cat No 4620; 1:20), horseradish peroxidase (HRP)-conjugated mouse FLAG antibody (Sigma; Cat No 8592; 1:5000), HRPconjugated mouse HA antibody (Cell Signaling Technology; Cat No 2999; 1:5000), and HRP-conjugated b-actin mouse antibody (Sigma; Cat No A3854; 1:10 000).

Techniques: Inhibition, Activity Assay, In Vivo, Knock-Out, Blocking Assay, Phospho-proteomics, Activation Assay, Injection, Immunohistochemical staining, Staining, TUNEL Assay, Expressing, Two Tailed Test

Journal: Brain : a journal of neurology

Article Title: Parkin interacting substrate phosphorylation by c-Abl drives dopaminergic neurodegeneration.

doi: 10.1093/brain/awab356

Figure Lengend Snippet: Figure 7 Y137F-PARIS-mediated suppression c-Abl-PARIS pathway rescues MDM4 repression, blocks p53 activation and prevents development of motor deficits and dopamine neuron loss in parkin knockout mice. (A) Representative exploratory paths from an open field test of 6-month-old wild- type littermate or homozygous floxed parkin mice (parkinfl/fl) nigrally injected with AAV-GFPCre (3 months) AAV-PARIS-Y137F (3 months, phospho- deficient mutant PARIS). (B) Anxiety assessment of each experimental mouse group examining the percentage of exploration time in the border ver- sus the sum of the centre and periphery zones (n = 8 mice per group). (C) Pole test for motor function assessment of each experimental mouse group used in B examining the latency to reach the base of the vertical pole (n = 8 mice per group). (D) Representative TH immunohistochemical staining of substantia nigra from wild-type littermate or homozygous floxed parkin mice (parkinfl/fl) with intranigral injection of AAV-GFPCre AAV-PARIS-Y137F. Scale bar = 500 mm. (E) Stereological assessment of TH-positive dopaminergic neurons in the SNpc (injection side) of the indicated mouse groups (n = 4 mice per group). (F) Representative TUNEL assay images of ventral midbrain from wild-type littermate or homozygous floxed parkin mice (par- kinfl/fl) that experienced stereotaxic nigral injection of AAV-GFPCre AAV-PARIS-Y137F. The coronal brain sections were counterstained with DAPI. Merged images are shown in the bottom panel. (G) Quantification of the percentage of TUNEL-labelled cells in AAV-GFPCre-injected ventral midbrain regions from wild-type littermate and parkinfl/flmice AAV-PARIS-Y137F (n = 16 sections from four mice per group). (H) Representative immunoblots examining the expression of pY245-c-Abl, c-Abl, pY137-PARIS, PARIS, MDM4, pS15-p53, and parkin in the AAV-GFPCre AAV-PARIS-Y137F-injected ventral midbrain regions from wild-type littermate and parkinfl/flmice using the indicated antibodies. b-Actin serves as an internal loading control. (I) Quantification of the relative expression of pY245-c-Abl, c-Abl, pY137-PARIS, PARIS, MDM4, pS15-p53 and parkin proteins normalized to b-actin in the indicated experimental groups (n = 4 mice per group). Data are expressed as mean SEM. Statistical analysis was performed using an ANOVA test followed by Tukey’s post hoc analysis or an unpaired two-tailed Student’s t-test. ***P 5 0.001. WT = wild-type.

Article Snippet: The following primary antibodies were used: rabbit GFP antibody (Cell Signaling Technology; Cat No 2956; 1:5000), mouse GFP antibody (Santa Cruz Biotechnology, Cat No sc9996, 1:500), mouse FLAG antibody (Sigma; Cat No F1804; 1:50 for immunoprecipitation), rabbit PARIS (ZNF746) antibody (Proteintech; Cat No 24543-1-AP; 1:5000), rabbit antibody to phosphorylated c-Abl (Cell Signaling Technology; Cat No 2868; 1:5000), mouse c-Abl antibody (Sigma; Cat No A5844; 1:5000), rabbit MDM4 antibody (Proteintech; Cat No 17914-1-AP; 1:5000), mouse antibody to phosphorylated p53 (Cell Signaling Technology; Cat No 9284; 1:5000), mouse p53 antibody (Santa Cruz Biotechnology; Cat No sc126; 1:5000), mouse PGC-1a antibody (Calbiochem, Cat No ST1202), rabbit NRF1 antibody (Abcam, Cat No ab34682), rabbit tyrosine hydroxylase (TH) antibody (Novus Biologicals; Cat No NB300-109; 1:2000), mouse TH antibody (ImmunoStar; Cat No 22941; 1:2000), mouse parkin antibody (Cell Signaling Technology; Cat No 4211; 1:5000), rabbit acetyl-histone H3 antibody (Merck Millipore; Cat No 06-599; 1:20), rabbit Histone H3 antibody (Cell Signaling Technology; Cat No 4620; 1:20), horseradish peroxidase (HRP)-conjugated mouse FLAG antibody (Sigma; Cat No 8592; 1:5000), HRPconjugated mouse HA antibody (Cell Signaling Technology; Cat No 2999; 1:5000), and HRP-conjugated b-actin mouse antibody (Sigma; Cat No A3854; 1:10 000).

Techniques: Activation Assay, Knock-Out, Injection, Mutagenesis, Immunohistochemical staining, Staining, TUNEL Assay, Western Blot, Expressing, Control, Two Tailed Test

Journal: Developmental cell

Article Title: Acute brain vascular regeneration occurs via lymphatic transdifferentiation.

doi: 10.1016/j.devcel.2021.09.005

Figure Lengend Snippet: Figure 2. The transdifferentiating iLVs switch molecular and structural identities and are restricted to stand-alone iLVs (A–C) The lyve1b+kdrl BLECs in the uninjured control (arrows), but not the transdifferentiating lyve1b+kdrl+ iLVs at 3 dpt after injury (arrowheads), were positive for anti-Prox1 (A) and fluorescence in situ hybridization (FISH)-vegfr3 (B). The statistics show the ratios of vessels positive for anti-Prox1 or FISH-vegfr3 among all the lyve1b+kdrl vessels and all the lyve1b+kdrl+ vessels. (C) (n = 6 larvae; two-way ANOVA by Dunnett’s multiple comparisons test; ***, p < 0.0001). Scale bar, 20 mm. (D and E) Positive control brain BVs in the uninjured larvae (D), the lineage-tracing system indicated that the vessels double positive for GFP and Dendra2 (E, arrow) and single positive for Dendra2 (D and E) expressed the blood-brain barrier marker glut1b, but vessels single positive for GFP (D, arrowhead) did not. Scale bar, 20 mm. (F–H) Single FIB-SEM image planes (right row) indicate cross sections of the vessels shown in the left row. Note that the mural of the DsRed+Dendra2+ vessel (G) is similar to the DsRed-Dendra2+ BV (H) but much thicker than the DsRed+Dendra2 iLV (F). Color rings mark the inner and outer surfaces of murals. Arrows indicate blood cells. Scale bars, 20 and 1 mm. (I–L) Live imaging shows BLECs (I), stand-alone iLVs (J, arrows), and track iLVs (K) at 2 and 4 dpt. Note that only the stand-alone iLVs express Dendra2 and recruit the GFP+ pericytes at 4 dpt (J, arrowheads). (L) The statistics show the ratios of transdifferentiation in the stand-alone iLVs and track iLVs at 4 dpt (n = 9 larvae; two-tailed unpaired t test; ***, p < 0.0001). Scale bar, 50 mm. (M–P) The TUNEL signals in the stand-alone iLVs (M) and track iLVs (N) at 7 dpt. The statistics show the ratios of TUNEL+ cells in stand-alone iLVs and in track iLVs (O) (n = 9 larvae; ***, p < 0.0001), and the ratios of iLVs undergoing transdifferentiation (Dendra2+GFP+) or undergoing apoptosis (GFP+TUNEL+) among all the iLVs at 7 dpt (P) (n = 30 larvae; two-tailed unpaired t test; ***, p < 0.0001). Scale bar, 50 mm. Data are represented as mean ± SD. See also Figure S2.

Article Snippet: Antibody staining, combination of FISH and antibody staining Whole-mount antibody staining and combination of FISH and antibody staining were performed as previously described (Chen et al., 2019; Liu et al., 2016; He et al., 2019, 2020) using antibodies against DsRed (1:200, Santa-Cruz), GFP or Venus (1:500, Abcam and Santa Cruz), Dendra2 (1:500, Antibody-online), Prox1 (1:1000, Abcam), and phospho-EphB4a (1:250, Signalway Antibody).

Techniques: Control, In Situ Hybridization, Positive Control, Marker, Imaging, Two Tailed Test, TUNEL Assay

Journal: Developmental cell

Article Title: Acute brain vascular regeneration occurs via lymphatic transdifferentiation.

doi: 10.1016/j.devcel.2021.09.005

Figure Lengend Snippet: Figure 4. Defective EphB4a leads to derepression of Notch in the track iLVs (A–L) Triple labeling of anti-Dendra2, anti-GFP, and FISH-dll4 (A–C)/notch1a (E–G)/hey1 (I–K). In the siblings, dll4/notch1a/hey1 were activated in the Dendra2+GFP+ stand-alone iLVs (A, E, and I) and Dendra2+GFP nascent BVs (B, F, and J), but not in the Dendra2GFP+ track iLVs (B, F, and J). By contrast, in the ephB4a mutant, the Dendra2GFP+ track iLVs at 3 dpt also exhibited dll4, notch1a, and hey1 expressions (C, G, and K). The statistics show the dll4/notch1a/ hey1 expression in the vessels of sibling and ephB4a mutant (D, H, and L) (n = 6 larvae; two-tailed unpaired t test; ***, p < 0.0001). (M–P) The Notch functional reporter tp1:Venus was activated in the Dendra2+DsRed+ stand-alone iLVs (M) and Dendra2+DsRed nascent BVs (N), but not in the Dendra2DsRed+ track iLVs (N). By contrast, in the ephB4a mutant, the Dendra2DsRed+ track iLVs at 3 dpt also exhibited Venus expression (O). The statistics show the tp1:Venus expression in the vessels of siblings and ephB4a mutants (P) (n = 6 larvae; two-tailed unpaired t test; ***, p < 0.0001). Scale bar, 20 mm. Data are represented as mean ± SD. See also Figures S6 and S7.

Article Snippet: Antibody staining, combination of FISH and antibody staining Whole-mount antibody staining and combination of FISH and antibody staining were performed as previously described (Chen et al., 2019; Liu et al., 2016; He et al., 2019, 2020) using antibodies against DsRed (1:200, Santa-Cruz), GFP or Venus (1:500, Abcam and Santa Cruz), Dendra2 (1:500, Antibody-online), Prox1 (1:1000, Abcam), and phospho-EphB4a (1:250, Signalway Antibody).

Techniques: Labeling, Mutagenesis, Expressing, Two Tailed Test, Functional Assay

Journal: Developmental cell

Article Title: Acute brain vascular regeneration occurs via lymphatic transdifferentiation.

doi: 10.1016/j.devcel.2021.09.005

Figure Lengend Snippet: Figure 5. EphB4a represses track iLV transdifferentiation through suppression of Notch (A–C) The derepressed transdifferentiation of track iLV (Dendra2+DsRed+) in the ephB4a mutant (A, arrow) was rescued by treatment with DAPT, which returned to Dendra2DsRed+ (B, arrowheads). The statistics show the ratios of transdifferentiation among track iLVs in the ephB4a mutant with or without DAPT treatment (C) (n = 10 larvae; two-tailed unpaired t test; ***, p < 0.0001). (D–G) The derepressed transdifferentiation of track iLV (Dendra2+GFP+) in the ephB4a mutant without heat shock (D, arrow) or without dnMAML-Flag (E, arrow) was rescued by the heat-shock-induced, LEC-specific overexpression of dnMAML-Flag, which exhibited Dendra2GFP+ at 4 dpt (F, arrowhead). The statistics show the ratios of transdifferentiation among track iLVs in the ephB4a mutant groups (G) (n = 10 larvae; two-tailed unpaired t test; ***, p < 0.0001). Scale bar, 20 mm. Data are represented as mean ± SD. HS, heat shock. See also Figures S6 and S7.

Article Snippet: Antibody staining, combination of FISH and antibody staining Whole-mount antibody staining and combination of FISH and antibody staining were performed as previously described (Chen et al., 2019; Liu et al., 2016; He et al., 2019, 2020) using antibodies against DsRed (1:200, Santa-Cruz), GFP or Venus (1:500, Abcam and Santa Cruz), Dendra2 (1:500, Antibody-online), Prox1 (1:1000, Abcam), and phospho-EphB4a (1:250, Signalway Antibody).

Techniques: Mutagenesis, Two Tailed Test, Over Expression

Journal: Journal of immunology research

Article Title: Alda-1 Ameliorates Liver Ischemia-Reperfusion Injury by Activating Aldehyde Dehydrogenase 2 and Enhancing Autophagy in Mice.

doi: 10.1155/2018/9807139

Figure Lengend Snippet: Figure 2: Alda-1 pretreatment alleviates apoptosis in liver IRI both in vivo and in vitro. (a, b) Representative sections of TUNEL staining and the numbers of TUNEL-positive cells in liver sections at 6 h after reperfusion or sham operation. Scale bars: 50 μm. (c, d) Representative sections of cleaved caspase-3 staining and the number of cleaved caspase-3-positive cells at 6 h after reperfusion or sham operation. Scale bars: 25 μm. (e) Western blot analysis of Bcl2 and Bax expression in liver tissues at 6 hours after reperfusion or sham operation (β-actin is used as a loading control). (f) Western blot analysis of Bcl2 and Bax expression in primary hepatocytes after HR challenge (β-actin is used as a loading control). All data are shown as mean ± SEM (n = 4–6). ∗P < 0 05.

Article Snippet: The primers used for RT-PCR analysis are as follows: (i) MCP1: F GGGCCTGCTGTTCACAGTT (ii) MCP1: R CCAGCCTACTCATTGGGAT (iii) IL-6: F TAGTCCTTCCTACCCCAATTTCC (iv) IL-6: R TTGGTCCTTAGCCACTCCTTC (v) TNF-α: F CCCTCACACTCAGATCATCTTCT (vi) TNF-α: R GCTACGACGTGGGCTACAG (vii) IL-1β: F TGGACCTTCCAGGATGAGGACA (viii) IL-1β: R GTTCATCTCGGAGCCTGTAGTG (ix) β-Actin: F TGACAGGATGCAGAAGGAGA (x) β-Actin: R ACCGATCCACACAGAGTACT The primary antibodies against P62 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), cleaved caspase-3 (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bax (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bcl2 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), 4HNE (rabbit polyclonal, 1 : 1000, Abcam), ALDH2 (rabbit polyclonal, 1 : 3000, Proteintech), LC3B (rabbit polyclonal, 1 : 1000, Proteintech), and β-actin (1 : 20000, Sigma-Aldrich) were used.

Techniques: In Vivo, In Vitro, TUNEL Assay, Staining, Western Blot, Expressing, Control

Journal: Journal of immunology research

Article Title: Alda-1 Ameliorates Liver Ischemia-Reperfusion Injury by Activating Aldehyde Dehydrogenase 2 and Enhancing Autophagy in Mice.

doi: 10.1155/2018/9807139

Figure Lengend Snippet: Figure 6: Autophagy is involved in ALDH2 activation-induced protection of mouse liver IRI. (a) Western blot analysis of LC3B and P62 expression in liver tissues at 6 hours after reperfusion or sham operation (β-actin is used as a loading control). (b, c) Representative transmission electron micrographs showing autophagosomes in the ischemic liver tissues at 6 h after reperfusion (black arrows denote autophagosomes) and the number of autophagosomes in per 100 μm2 of the cytoplasm. PT: portal triads; CV: central veins. Scale bars: 50 μm. Scale bars: 1 μm. (d–g) Mice were treated with 3-methyladenine 1 h after Alda-1 or pretreated with DMSO and killed at 6 h after reperfusion. (d, e) Representative H&E-stained images and relative Suzuki’s scores of the liver section. Scale bars: 50 μm. (f) Serum ALT/AST level. (g) Western blot analysis of LC3B, P62, Bcl2, and Bax expression in liver tissues (β-actin is used as a loading control). All data are shown as mean ± SEM (n = 4–6). ∗P < 0 05.

Article Snippet: The primers used for RT-PCR analysis are as follows: (i) MCP1: F GGGCCTGCTGTTCACAGTT (ii) MCP1: R CCAGCCTACTCATTGGGAT (iii) IL-6: F TAGTCCTTCCTACCCCAATTTCC (iv) IL-6: R TTGGTCCTTAGCCACTCCTTC (v) TNF-α: F CCCTCACACTCAGATCATCTTCT (vi) TNF-α: R GCTACGACGTGGGCTACAG (vii) IL-1β: F TGGACCTTCCAGGATGAGGACA (viii) IL-1β: R GTTCATCTCGGAGCCTGTAGTG (ix) β-Actin: F TGACAGGATGCAGAAGGAGA (x) β-Actin: R ACCGATCCACACAGAGTACT The primary antibodies against P62 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), cleaved caspase-3 (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bax (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bcl2 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), 4HNE (rabbit polyclonal, 1 : 1000, Abcam), ALDH2 (rabbit polyclonal, 1 : 3000, Proteintech), LC3B (rabbit polyclonal, 1 : 1000, Proteintech), and β-actin (1 : 20000, Sigma-Aldrich) were used.

Techniques: Activation Assay, Western Blot, Expressing, Control, Transmission Assay, Staining

Journal: Journal of immunology research

Article Title: Alda-1 Ameliorates Liver Ischemia-Reperfusion Injury by Activating Aldehyde Dehydrogenase 2 and Enhancing Autophagy in Mice.

doi: 10.1155/2018/9807139

Figure Lengend Snippet: Figure 7: AMPK activation is involved in autophagy enhancement by Alda-1 pretreatment during liver IR. (a) Western blot analysis of p-AMPK and AMPK expression in liver tissues at 6 hours after reperfusion or sham operation (β-actin is used as a loading control). (b–d) Mice were treated with CC 1 h after Alda-1 or pretreated with DMSO and killed at 6 h after reperfusion. (b, c) Representative H&E-stained images and relative Suzuki’s scores of the liver section. PT: portal triads; CV: central veins. Scale bars: 50 μm. Scale bars: 50 μm. (d) Serum ALT/AST level. (e) Western blot analysis of p-AMPK, AMPK, Bcl2 and Bax, LC3B, and P62 expression in liver tissues (β-actin is used as a loading control). All data are shown as mean ± SEM (n = 4–6). ∗P < 0 05.

Article Snippet: The primers used for RT-PCR analysis are as follows: (i) MCP1: F GGGCCTGCTGTTCACAGTT (ii) MCP1: R CCAGCCTACTCATTGGGAT (iii) IL-6: F TAGTCCTTCCTACCCCAATTTCC (iv) IL-6: R TTGGTCCTTAGCCACTCCTTC (v) TNF-α: F CCCTCACACTCAGATCATCTTCT (vi) TNF-α: R GCTACGACGTGGGCTACAG (vii) IL-1β: F TGGACCTTCCAGGATGAGGACA (viii) IL-1β: R GTTCATCTCGGAGCCTGTAGTG (ix) β-Actin: F TGACAGGATGCAGAAGGAGA (x) β-Actin: R ACCGATCCACACAGAGTACT The primary antibodies against P62 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), cleaved caspase-3 (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bax (rabbit polyclonal, 1 : 1000, Cell Signaling Technology), Bcl2 (rabbit monoclonal, 1 : 1000, Cell Signaling Technology), 4HNE (rabbit polyclonal, 1 : 1000, Abcam), ALDH2 (rabbit polyclonal, 1 : 3000, Proteintech), LC3B (rabbit polyclonal, 1 : 1000, Proteintech), and β-actin (1 : 20000, Sigma-Aldrich) were used.

Techniques: Activation Assay, Western Blot, Expressing, Control, Staining

Journal: International journal of biological sciences

Article Title: Dioscin facilitates ROS-induced apoptosis via the p38-MAPK/HSP27-mediated pathways in lung squamous cell carcinoma.

doi: 10.7150/ijbs.45710

Figure Lengend Snippet: Figure 3. Dioscin induced cell apoptosis in lung SCC cells. NCI‐H520, SK‐MES‐1 and HBE cells were treated with dioscin (0, 1.25, 2.5, 5 µM) for 48 h. (A, B) Cell apoptosis was measured by flow cytometry. (C) The changes in ΔΨm were monitored by JC-1 staining and the ratio of green/red fluorescence intensity was used to calculate mitochondrial depolarization. Data are the mean ± SD of triplicate samples. Significant differences compared with the control are indicated by *p<0.05, **p<0.01, and***p<0.001. (D) The expression levels of cleaved caspase-3, cleaved PARP, Bax and Bcl-2 were analysed by western blot.

Article Snippet: Antibodies against Bcl2, Bax, cleaved caspase-3, cleaved PARP, p38, p-p38 (Thr180/ Tyr182), E-cadherin, N-cadherin and Vimentin were purchased from Cell Signalling Technology (Danvers, MA, USA).

Techniques: Flow Cytometry, Staining, Fluorescence, Control, Expressing, Western Blot

Journal: International journal of biological sciences

Article Title: Dioscin facilitates ROS-induced apoptosis via the p38-MAPK/HSP27-mediated pathways in lung squamous cell carcinoma.

doi: 10.7150/ijbs.45710

Figure Lengend Snippet: Figure 4. The p38-MAPK/HSP27 signalling pathway was involved in dioscin-induced apoptosis. (A) NCI‐H520 and SK‐MES‐1 cells were treated with dioscin (5 µM) for 48 h. The levels of p-p38, p38, p-HSP27 and HSP27 were analysed by western blotting. (B, C) NCI‐H520 and SK‐MES‐1 cells were treated with Anisomycin (0.5 µM) for 24 h. Then, cell apoptosis was measured by flow cytometry, and the expression levels of p-p38, p38, p-HSP27, HSP27, Bax, Bcl2, cleaved caspase-3 and cleaved PARP were analysed by western blotting. (D) NCI‐H520 and SK‐MES‐1 cells were pretreated with SB203580 (5 µM) for 2 h before exposure to dioscin for 48 h. Then, cell apoptosis was measured by flow cytometry. Data are presented as the mean ± SD of triplicate samples. *P < 0.05, **P < 0.01, and ***P < 0.001 vs control.

Article Snippet: Antibodies against Bcl2, Bax, cleaved caspase-3, cleaved PARP, p38, p-p38 (Thr180/ Tyr182), E-cadherin, N-cadherin and Vimentin were purchased from Cell Signalling Technology (Danvers, MA, USA).

Techniques: Western Blot, Flow Cytometry, Expressing, Control

Journal: International journal of biological sciences

Article Title: Dioscin facilitates ROS-induced apoptosis via the p38-MAPK/HSP27-mediated pathways in lung squamous cell carcinoma.

doi: 10.7150/ijbs.45710

Figure Lengend Snippet: Figure 5. Intracellular ROS accumulation was a pivotal event in dioscin-induced apoptosis. (A, B) NCI‐H520 and SK‐MES‐1 cells were treated with dioscin (5 µM) for 48 h. The intracellular ROS levels were measured by flow cytometry. Data are presented as the mean ± SD of triplicate samples. *p < 0.05, **p < 0.01, and ***p < 0.001 vs control. (C-H) NCI‐H520 and SK‐MES‐1 cells were pretreated with NAC (2 mM) for 24 h before exposure to dioscin for 48 h. Then, cell apoptosis and intracellular ROS levels were measured by flow cytometry. Data are presented as the mean ± SD of triplicate samples. *p < 0.05, **p < 0.01, and ***p < 0.001 vs control. The expression levels of cleaved caspase 3, cleaved PARP, Bax, Bcl2, p-p38, p38, p-HSP27 and HSP27 were analysed by western blotting.

Article Snippet: Antibodies against Bcl2, Bax, cleaved caspase-3, cleaved PARP, p38, p-p38 (Thr180/ Tyr182), E-cadherin, N-cadherin and Vimentin were purchased from Cell Signalling Technology (Danvers, MA, USA).

Techniques: Flow Cytometry, Control, Expressing, Western Blot

Journal: International journal of biological sciences

Article Title: Dioscin facilitates ROS-induced apoptosis via the p38-MAPK/HSP27-mediated pathways in lung squamous cell carcinoma.

doi: 10.7150/ijbs.45710

Figure Lengend Snippet: Figure 6. In vivo anti-tumour effects of dioscin in xenograft models. NCI-H520 cells were subcutaneously injected into the backs of BALB/c nude mice. When the tumour reached a volume of 50-100 mm3, mice were divided into two groups and orally treated with vehicle or dioscin (80 mg/kg/d) for 12 days (n=6). (A) The tumour volumes of the mice were determined every three days after the onset of treatment. (B, C) On day 12, the tumours were carefully dissected from the mice and the weights of tumours was measured. (D, E) Apoptotic cells in tumour samples were detected by TUNEL assay (scale bar=20 µm). Data are presented as the mean ± SD. Significant differences compared with the control are indicated by *p<0.05, **p<0.01, and***p<0.001. (F) The harvested tumours were subsequently lysed and western blot analysis was performed for cleaved caspase-3, cleaved PARP, Bax, Bcl2, p-p38, p38, p-HSP27, HSP27 and GAPDH expression.

Article Snippet: Antibodies against Bcl2, Bax, cleaved caspase-3, cleaved PARP, p38, p-p38 (Thr180/ Tyr182), E-cadherin, N-cadherin and Vimentin were purchased from Cell Signalling Technology (Danvers, MA, USA).

Techniques: In Vivo, Injection, TUNEL Assay, Control, Western Blot, Expressing

Journal: Frontiers in pharmacology

Article Title: Sini San Inhibits Chronic Psychological Stress-Induced Breast Cancer Stemness by Suppressing Cortisol-Mediated GRP78 Activation.

doi: 10.3389/fphar.2021.714163

Figure Lengend Snippet: FIGURE 6 | SNS interrupts the interaction between GRP78 and LRP5 to suppress Wnt/β-catenin signaling. (A) After 4T1 cells were treated with cortisol for 24 h, the translocation of GRP78 to the cell membrane was monitored by immunofluorescence. Red: DiI-cell membrane tracker; green: GRP78. Co-localization of GRP78 and the cell membrane is shown as yellow fluorescence. (B) The 4T1 cells were treated with cortisol for 24 h, and the co-localization of GRP78 and LRP5 was detected by immunofluorescence. Co-localization is shown as yellow fluorescence. (C) The effect of SNS (200 μg/ml) on cortisol-induced cell membrane translocation of GRP78 was detected by immunofluorescence following SNS treatment for 24 h. (D) The effect of SNS (200 μg/ml) on the co-localization of GRP78 and LRP5 induced by cortisol was detected by immunofluorescence following SNS treatment for 24 h. (E) The expression of LRP5, p-LRP5, and β-catenin in the GRP78-overexpressing 4T1 cells was measured by western blots. (F) The 4T1 cells or GRP78-overexpressing 4T1 cells were treated with SNS (200 μg/ml) for 24 h, and the changes in cortisol- induced LRP5, p-LRP5, and β-catenin expression were detected by western blots. (G) The 4T1 cells were treated with SNS (200 μg/ml) for 24 h, and changes in the interaction of GRP78 with LRP5 were analyzed by Co-IP assays. Input represents the total protein extracts prepared without the antibody coupling resin. NC indicates the negative control prepared by adding quenching buffer to the antibody coupling resin. NS, not significant. The scale bars indicate 10 μm. One representative experiment of three independent experiments is displayed.

Article Snippet: The primary antibody included GRP78 antibody (11587-1-AP, Proteintech, Rosemont, IL, United States), LRP5 (24899-1- AP, Proteintech, Rosemont, IL, United States); Fluorescently labeled anti-rabbit Alexa Fluor 488 and Alexa Fluor 555 conjugated antibodies were used as secondary antibodies.

Techniques: Translocation Assay, Membrane, Expressing, Western Blot, Co-Immunoprecipitation Assay, Negative Control

Journal: Frontiers in pharmacology

Article Title: Sini San Inhibits Chronic Psychological Stress-Induced Breast Cancer Stemness by Suppressing Cortisol-Mediated GRP78 Activation.

doi: 10.3389/fphar.2021.714163

Figure Lengend Snippet: FIGURE 7 | SNS inhibits CUMS-activated Wnt/β-catenin signaling in primary and metastatic lesions of breast cancer in mice. (A) The expression of Ki-67 in primary and metastatic lesions of the 4T1 tumor-bearing mice was detected by immunohistochemistry, reflecting the proliferation of breast cancer cells in vivo (the scale bars indicate 50 μm). (B) The TUNEL assays were used to detect in situ apoptosis in primary and metastatic lesions of the 4T1 tumor-bearing mice (the scale bars indicate 10 μm). (C) Membrane expression of GRP78 in the primary and metastatic lesions of the 4T1 tumor-bearing mice was detected by immunofluorescence (the scale bars indicate 10 μm). Red: DiI-cell membrane tracker; green: GRP78. Co-localization of GRP78 and the cell membrane is shown as yellow fluorescence. (D) The expression levels of LRP5, p-LRP5, and β-catenin in the primary tumors were measured by immunohistochemistry (the scale bars indicate 50 μm). Data are represented as the mean value ±SD. One representative experiment of three independent experiments is displayed. One-way ANOVA and Bonferroni’s post hoc test were applied.

Article Snippet: The primary antibody included GRP78 antibody (11587-1-AP, Proteintech, Rosemont, IL, United States), LRP5 (24899-1- AP, Proteintech, Rosemont, IL, United States); Fluorescently labeled anti-rabbit Alexa Fluor 488 and Alexa Fluor 555 conjugated antibodies were used as secondary antibodies.

Techniques: Expressing, Immunohistochemistry, In Vivo, TUNEL Assay, In Situ, Membrane

Journal: Frontiers in pharmacology

Article Title: Sini San Inhibits Chronic Psychological Stress-Induced Breast Cancer Stemness by Suppressing Cortisol-Mediated GRP78 Activation.

doi: 10.3389/fphar.2021.714163

Figure Lengend Snippet: FIGURE 8 | SNS inhibits CUMS-induced lung metastasis and stemness of breast cancer. SNS interrupts the interaction between GRP78 and LRP5 on the cell surface, thus inhibiting the Wnt/β-catenin signaling of breast CSCs.

Article Snippet: The primary antibody included GRP78 antibody (11587-1-AP, Proteintech, Rosemont, IL, United States), LRP5 (24899-1- AP, Proteintech, Rosemont, IL, United States); Fluorescently labeled anti-rabbit Alexa Fluor 488 and Alexa Fluor 555 conjugated antibodies were used as secondary antibodies.

Techniques: